Search Result

Results for "

messenger RNA

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (2) Small Interfering RNA (siRNA) (5) Endogenous Metabolite (4) Factor Xa (3) HBV (2) Histone Methyltransferase (2) Influenza Virus (3) Isotope-Labeled Compounds (4) Liposome (3) Parasite (1) Transthyretin (TTR) (2)
By Research Areas:	Cancer (2) Infection (7) Inflammation/Immunology (2) Neurological Disease (4)

Inhibitors & Agonists

Biochemical Assay Reagents

Natural
Products

Isotope-Labeled Compounds

Targets Recommended: DNA/RNA Synthesis Small Interfering RNA (siRNA)

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-151507

306Oi10

Liposome Others

306Oi10 is a branched-chain ionizable lipidoid that can be used for constructing lipid nanoparticles (LNPs) for the delivery of messenger RNA .

306Oi10	Liposome	Others
306Oi10 is a branched-chain ionizable lipidoid that can be used for constructing lipid nanoparticles (LNPs) for the delivery of messenger RNA .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-132587A

Fitusiran sodium ALN-AT3SC sodium; SAR439774 sodium	Factor Xa	Others
Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .

HY-132587

Fitusiran ALN-AT3SC; SAR439774	Small Interfering RNA (siRNA) Factor Xa	Others
Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-150224

GalNAc unconjugated/naked Fitusiran sodium	Small Interfering RNA (siRNA) Factor Xa	Others
GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .

HY-112980

Nusinersen	DNA/RNA Synthesis	Inflammation/Immunology
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .

HY-112980A

Nusinersen sodium	DNA/RNA Synthesis	Inflammation/Immunology
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .

HY-143700

18:0 DAP

Liposome Neurological Disease

18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .

18:0 DAP	Liposome	Neurological Disease
18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .

HY-N0086

N6-Methyladenosine 5 Publications Verification 6-Methyladenosine; N-Methyladenosine	Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-132609

Patisiran sodium	Small Interfering RNA (siRNA) Transthyretin (TTR)	Neurological Disease
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .

HY-114208A

BI-9321 trihydrochloride	Histone Methyltransferase	Cancer
BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a K_d value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC₅₀ of 1.2 μM in U2OS cells .

HY-114208

BI-9321	Histone Methyltransferase	Cancer
BI-9321 is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a K_d value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC₅₀ of 1.2 μM in U2OS cells .

HY-153609

AS-Patisiran sodium	Transthyretin (TTR) Small Interfering RNA (siRNA)	Neurological Disease
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .

HY-132610

Givosiran ALN-AS1	Small Interfering RNA (siRNA)	Neurological Disease
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .

HY-153238

AN15368	Parasite	Infection
AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .

HY-W010970

5'-Guanylic acid disodium salt 1 Publications Verification 5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt	Endogenous Metabolite	Others
5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .

HY-P0063

Copper tripeptide 1 Publications Verification GHK-Cu
Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .

HY-N0086S

N6-Methyladenosine-d3 6-Methyladenosine-d₃; N-Methyladenosine-d₃	Isotope-Labeled Compounds	Infection
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-N0086S2

N6-Methyladenosine-13C4 6-Methyladenosine-¹³C₄; N-Methyladenosine-¹³C₄	Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-N0086S3

N6-Methyladenosine-13C3 6-Methyladenosine-¹³C₃; N-Methyladenosine-¹³C₃	Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

HY-156985

Lipid AX4	Isotope-Labeled Compounds Liposome	Others
Lipid AX4 is an ionizable cationic lipid with the _pK_a of 6.89， and can be used the study for the formation of lipid nanoparticles (LNPs) for the delivery of mRNA in vivo .

306Oi10	Drug Delivery
306Oi10 is a branched-chain ionizable lipidoid that can be used for constructing lipid nanoparticles (LNPs) for the delivery of messenger RNA .

18:0 DAP	Drug Delivery
18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N0086

N6-Methyladenosine 5 Publications Verification 6-Methyladenosine; N-Methyladenosine	Infection Structural Classification Natural Products Microorganisms Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Influenza Virus Endogenous Metabolite
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-W010970

5'-Guanylic acid disodium salt 1 Publications Verification 5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt	Classification of Application Fields Ketones, Aldehydes, Acids Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite
5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .

Cat. No.	Product Name	Chemical Structure

HY-N0086S

N6-Methyladenosine-d3
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-N0086S2

N6-Methyladenosine-13C4
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-N0086S3

N6-Methyladenosine-13C3
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

Name
Email *

	Sorry, but the email address you supplied was invalid.

messenger RNA

Inhibitors & Agonists

Biochemical Assay Reagents

NaturalProducts

Isotope-Labeled Compounds

Natural
Products